Conferences

Date By Date Accessioned By Title By Author Communities in this Community Now showing 1 - 5 of 5 Results Per Page 1 5 10 20 40 60 80 100 Sort Options Ascending Descending DIMVA   Detection of Intrusions and …

G:PhD backupThesisStigterEA_Dissertation_final.pdf

% !"!#$%&'()*+, -& &. &%& *&".*/&"01%&()"2.#")&,3 .%#4/ $*,3##5#" (6)&. 4* #" !#78# ,39%& "* *:%&*%&%&2 .( "./ $*5)&*$,4$ :,*(6&.#*# )&;<=>.3%&)&,35.%#(6;<=>.?@AB?CDE%&?@AB?BE:#"!,35 4#%&/ [...] &""$ ""'("!$$#"$$ $ %#)*+,#%""( -)*+,%$(# ./01.234"#$&$$" " " !"" $"## &""$#%""$" % -$$ "" 5&"""#")*+,6%""%""$ "#" " # % "#$ 789 : %"%;" ./01.234 " ""$#%"$$$$"<%$ %;"%" #(! )*+,6 7896 …

KOMDAT19-6vp.vp

1 3 < 6,5 J. 2.088.176 88,1 +0,8 24,2 +7,0 6,5 < 10 J. 176.830 7,3 +1,4 80,6 -1,9 Östliche Bundesländer ohne Berlin < 3 J. 108.944 37,0 +2,2 97,8 +1,1 3 < 6,5 J. 341.328 105,1 -8,3 98,1 +0,5 6,5 < 10 J [...] Bereiche Kindertagesbetreuung und Hilfen zur Erziehung, die zwar pro- zentual nur Steigerungen von 5,7% und 7,5% aufweisen, aber zusammen auf ein Zuwachsvolumen von 771 Mio. EUR (468 Mio. EUR/303 Mio. EUR) [...] Weg in die Teilzeitbeschäftigung . . . . . . . . . . . 5 Befristete Arbeitsplätze in der Jugendhilfe nehmen zu. . . . . . . . . . . . . . . . . 5 Notizen Statistische Ämter, Neues aus der Arbeitsstelle …

)&68¾°)! ,/)5&68ü; @ )! @ Þ)5%/,/% @ &8T¿)3 68 B ))! B ))!MôL9Ä)!% B ,789Ä9K·9Ä)!o Å @ É®©$))!681)!á,/) °%¹;&M)!&4)ï T%9Ä)!³M;)ÿj%17#;&68)ïâ ° B );)&D'*4¿)³&! Åw6QÉ®©$))!681)! ,/)Û;)Ûº à ' )) ;)5 T%9-)³)$&Q´M) [...] )´)!#& @ )&)m5/;)##)j%&%³)!&68)!;#68):5/;)##7#&&)! &)o;1)!³&68o;1))&)í/;1)!##T#õ&&) @ )!&.!))!1;#68);1).½´$))%1)!;1#681)ÃL"q 9Ä)!7Ü &o7' )#68)&7;)##o)9-01±)!#Þ¹&68&68³#68;)!¹&4%³%)!##)!5²M&9Ä19Ä)!% B [...] 9:%;< ==/ >% ?A@B @ )C @ &D=E1GF/=H1CIHHKJLM N7OQP RTSU/V1S7NWYXOTNZX\[T]<^_`RaTbc7[T]/`$Xd`/e fg5hjikmlon/kqp/imrtsu2rvwn1xyikml z {4|/|1}~|1}~$} D~{4~Z1}~Mj~}~ uon/rxQn1n/xQn7r2o< Kvy*/  ¡¢1£¤¦¥T§¨w¥ …

®YºY¢ ¥ & º = p>c<e3DiO®Yºc32dDPL=5sO.;4l79.@2@:hD²£e2548.`n048.`aC&Fi6CI=d:x.;484=,4k68c32@:®Oo)!=5s7e3F"c PL=@s>.;4`a.;03.;:3`D^=,:{c=@s eS:.@²*e325P6c.l6KsO=DKCu`a.@D>=5? < » ®>¯¡> 8q¢3B -~» ® ¯¡^ 8/¢ [...] CLPIPLe3DK64"256CI=d:=5?k6c.03=,CI:<6"D 72,`a.CI:68cS.9048.1HaCL=,e3D(DE.@Fi68CL=,:o¬~CL68c`2@6"2=5?j68c.?R=,487 ¥ * "¡ ¢"g¤ ¥ ¦d ;§;§;§1 "¨n©qs^c.148.l¡x¥z +  ;§1§;§i  ¢gFi=d:3DKCuDK6JD>=5? 048.`aC&Fi6=, [...] 168c=<`(Fi=d:3DKCuDK6JDf=5??R=,479CI:_!04.@`aC&F$68=,4JDg® + ¯¡¢J ;§;§;§$ "®w¯¡>¢s^c.;4..2,F"cm® CuDqPICI:S.@254!CI:m¡µ25:3`m`a.;03.;:`Dq=,:m=,:PLM =5?^6c. hHd2@48C&2 } PI.Dio(p>c.1: =d:.!=5?6c.l@® !©/CuDgFÓc=BDK …

In silico design for synthesis of molecularly imprinted microspheres specific towards bisphenol A by

together with the following sense (prim5ZZ_for: 5′- AAAAGAGCTCGTAGACAACAAATTCA ACAAAGAAC-3′) and antisense primers (prim3ZZ_rev: 5′-AAAACTGCAGTCATTT 166 + Sac I Pst I : primer 5ZZ : primer 3ZZ Amplification zzSac [...] 34.3 kDa 40.9 kDa 1 2 3 4 5 6 7 8 9 34.3 kDa 40.9 kDa 1 2 3 4 5 6 7 8 9 Figure 5: SDS-PAGE demonstrating purification of H6GFPZ (upper gel) and H6GFPZZ (lower gel). Lane 2-5 were samples from IMAC and [...] mixture of 0.1 µM of H6_1 (5′CATGGGTCATCACCATCACCATCAC CGGCGCCTGAGCATC-3′) (MWG Bio- tech). Parts of both primers are identical to the Z encoded gene, prim5ZZ includes a 5′ overhang containing a SacI …

Microsoft Word - AlarmReductionDIMVA041_corr1.doc

100 97,5 97,5 97,5 100 97,4 100 100 100 100 100 72,2 100 100 97,5 100 100 99,3 97,5 100 97,5 97,5 97,5 100 100 ZID 100 82,0 82,0 81,7 90,5 81,1 90,9 90,5 100 90,5 90,5 54,4 100 90,5 81,7 82,3 90,5 86,0 82 [...] 82,2 91,3 81,7 81,7 82,3 100 100 ZIE 100 0 99,5 99,5 100 0 100 100 100 100 100 0 100 100 80,1 0 100 100 99,5 100 99,5 99,5 99,5 100 100 ZIP 100 0 2,3 0 0 0 0 0 100 0 0 0 100 0 22,2 0 0 0 0 0,9 0 0 0 100 [...] 0,7 100 0,5 100 100 100 0 0 0 100 100 PAK 100 100 100 100 100 97,9 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 RA1 100 0 0 0 0 0 95,0 0 100 95,0 0 100 100 99,5 100 100 0 …